Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
BSBV1 |
PKB-number: | PKB36 |
Definition: | tRNA-like structure 3'end pseudoknot of RNA 1 of beet soil-borne virus |
Organism: | beet soil-borne virus |
Abbreviation: | BSBV1 |
RNA type: | Viral tRNA-like |
Keywords: | furovirus; RNA 3'end |
EMBL number: | Z97873 |
Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
Supported by: | Sequence comparison |
References: |
[1] Koenig R., Loss S. J.Gen.Virol.1997, 78:3161-3165.
[2] Koenig et al. J.Gen.Virol. 1998, 2027-2036. |
Stem sizes: Loop sizes: |
3 5 4 0 3 |
Position Paired: | 5809-5811; 5821-5823 5816-5820; 5827-5831 |
Bracket view of structure: |
5800 5810 5820 5830 # 456789|123456789|123456789|123456789|1234 $ 5794 GGGGUGCAAAUCCCCCCCUUUACUUGAGGGAAAUCAAGCCC=5834 % 5794 :::::::::::::::(((::::[[[[[))):::]]]]]:::