Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
BYDV-NY-RPV |
PKB-number: | PKB46 |
Definition: | ORF2/ORF3 (putative RNA-dependent RNA polymerase) ribosomal frameshift site of barley yellow dwarf virus, NY-RPV isolate |
Organism: | barley yellow dwarf virus |
Abbreviation: | BYDV-NY-RPV |
RNA type: | Viral Frameshift |
Keywords: | luteovirus; ribosomal frameshifting; RNA polymerase |
EMBL number: | L25299 |
Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
Supported by: | Sequence comparison |
References: |
[1] Vincent JR et al. J.Gen.Virol. 1991, 72:2347-2355
[2] ten Dam EB. (1995). Ph.D.Thesis, Leiden University. |
Stem sizes: Loop sizes: |
5 4 2 0 7 |
Position Paired: | 1706-1710; 1717-1721 1713-1716; 1729-1732 |
Bracket view of structure: |
1700 1710 1720 1730 # 456789|123456789|123456789|123456789|12 $ 1694 GGGAAACGGGAAGGCGGCGGCGUCCGCCGUAACAAACGC=1732 % 1694 ::::::::::::(((((::[[[[))))):::::::]]]]