Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
NGF-L2 |
PKB-number: | PKB132 |
Definition: | The pseudoknot of SELEX-isolated ligand L2 to human nerve growth factor |
Organism: | |
Abbreviation: | NGF-L2 |
RNA type: | Aptamers |
Keywords: | SELEX; nerve growth factor |
EMBL number: | |
Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
Supported by: | Sequence comparison; Structure probing |
References: | [1] Binkley J. et al. (1995). Nucleic Acids Res. 23:3198-3205. |
Stem sizes: Loop sizes: |
5 5 2 0 27 |
Position Paired: | 1-5; 13-17 8-12; 45-49 23-29; 37-43 |
Bracket view of structure: |
10 20 30 40 # 123456789|123456789|123456789|123456789|123456789 $ 1 CGCUCAACCUCAGAGCGCAAGAGUCGAACGAAUACAGUUCGACAUGAGG=49 % 1 (((((::[[[[[))))):::::(((((((:::::::))))))):]]]]]