Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
MIDV |
PKB-number: | PKB352 |
Definition: | 6K/TF ribosomal frameshift site of Middelburg virus |
Organism: | Middelburg virus |
Abbreviation: | MIDV |
RNA type: | Viral Frameshift |
Keywords: | Togaviridae; Alphavirus; ribosomal frameshifting |
EMBL number: | AF339486 |
Submitted by: | A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl) |
Supported by: | Mutagenesis,Sequence comparison |
References: |
[1] Firth AE et al. (2008) Virol. J. 5:108.
[2] Chung BYW et al. (2010). J. Mol. Biol 397:448-456. |
Stem sizes: Loop sizes: |
10 7 3 1 13 |
Position Paired: | 3047-3049; 3077-3079 |
Bracket view of structure: |
3040 3050 3060 3070 3080 3090 3100 # 123456789|123456789|123456789|123456789|123456789|123456789|123456789| $ 3031 UUCUUUUUUAGUGGCAGUAAGCCUGGGAAUGGGGGCGACCCAGGCGUAUGAACAUAGUGUAACGCUCCCC=3100 % 3031 ::::::::::::::::(((:(((((((:::[[[[[[[:))))))):))):::::::::::::]]]]]]]: