Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
MIDV

PKB-number: PKB352
Definition: 6K/TF ribosomal frameshift site of Middelburg virus
Organism: Middelburg virus
Abbreviation: MIDV
RNA type: Viral Frameshift
Keywords: Togaviridae; Alphavirus; ribosomal frameshifting
EMBL number: AF339486
Submitted by: A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison
References: [1] Firth AE et al. (2008) Virol. J. 5:108.
[2] Chung BYW et al. (2010). J. Mol. Biol 397:448-456.
Stem sizes:
Loop sizes:
10 7
3 1 13
Position Paired:
3047-3049; 3077-3079
3051-3057; 3069-3075
3061-3067; 3093-3099
Bracket view of structure:
             3040      3050      3060      3070      3080      3090      3100
#      123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 3031 UUCUUUUUUAGUGGCAGUAAGCCUGGGAAUGGGGGCGACCCAGGCGUAUGAACAUAGUGUAACGCUCCCC=3100
% 3031 ::::::::::::::::(((:(((((((:::[[[[[[[:))))))):))):::::::::::::]]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2011-4-25 PKB00352.HTML