Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
LiRMV3 |
PKB-number: | PKB392 |
Definition: | tRNA-like structure pseudoknot of RNA3 |
Organism: | Lilac ring mottle virus |
Abbreviation: | LiRMV3 |
RNA type: | Viral tRNA-like |
Keywords: | Bromoviridae; Ilarvirus |
EMBL number: | U17391 |
Submitted by: | A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl) |
Supported by: | Sequence comparison |
References: |
[1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83. |
Stem sizes: Loop sizes: |
13 4 7 0 64 |
Position Paired: | 2161-2167; 2209-2215 |
Bracket view of structure: |
2170 2180 2190 2200 2210 2220 # 123456789|123456789|123456789|123456789|123456789|123456789| $ 2161 GUUUGUAUUCCGACUGUUUGUUUCUCCCAGUCGAUGCCUGUUGGUGUUUACAGACGAGUA=2220 % 2161 (((((((:::((((((:::::::[[[[))))))(((((::::))))):)))))))::((( 2230 2240 2250 2260 2270 2280 # 123456789|123456789|123456789|123456789|123456789|123456789| $ 2221 UGGUAUUGACCAUAUGUUCCUAUUCUCUCUCUCAGGAGAGGAGAAUAGAUGCCUCCAAAG=2280 % 2221 ((((::::)))))))::::((((((((((((::::)))):)))))))):::::::::::] # 1234567 $ 2281 GAGUCGC=2287 % 2281 ]]]::::