 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Mo-MuLV |  |
|||
| PKB-number: | PKB47 |
| Definition: | Gag/pol translational readthrough site of Moloney murine leukemia virus |
| Organism: | Moloney murine leukemia virus |
| Abbreviation: | Mo-MuLV |
| RNA type: | Viral Readthrough |
| Keywords: | retrovirus type C; translational readthrough; gag-pol |
| EMBL number: | AF033811 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison; Structure probing |
| References: |
[1] ten Dam,E. et al. Virus Genes 1990, 4:121-136.
[2] Wills NM, Gesteland RF & Atkins JF. EMBO J. 1994, 13:4137-4144. |
| Stem sizes: Loop sizes: |
8 7 1 0 18 |
| Position Paired: | 1982-1985; 2003-2006 1986-1989; 1998-2001 1991-1997; 2025-2031 |
| Bracket view of structure: |
1980 1990 2000 2010 2020 2030
# 123456789|123456789|123456789|123456789|123456789|123456789|1
$ 1971 UAGGGAGGUCAGGGUCAGGAGCCCCCCCCUGAACCCAGGAUAACCCUCAAAGUCGGGGGGC=2031
% 1971 :::::::::::((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]]