 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
EIAV |  |
|||
| PKB-number: | PKB3 |
| Definition: | Gag-pol ribosomal frameshift site of Equine Infectious Anemia Virus |
| Organism: | Equine Infectious Anemic Virus |
| Abbreviation: | EIAV |
| RNA type: | Viral ribosomal frameshifting |
| Keywords: | retroviridae; ribosomal frameshift; gag-pol |
| EMBL number: | AF033820 |
| Submitted by: | J. Ng ( JackTown@Hotmail.com) |
| Supported by: | Sequence comparison |
| References: |
[1] ten Dam E., Pleij C.W.A., & Bosch L.(1990). Virus Genes 1990, 4, 121-136.
[2] Stephens,R.M., et al.(1986). Science 231, 589-594. |
| Stem sizes: Loop sizes: |
6 4 3 0 12 |
| Position Paired: | 1797-1802; 1810-1815 1806-1809; 1828-1831 |
| Bracket view of structure: |
1790 1800 1810 1820 1830
# 123456789|123456789|123456789|123456789|123456789|1234
$ 1781 AAAAAACGGGAAGCAAGGGGCUCAAGGGAGGCCCCAGAAACAAACUUUCCCGAU=1834
% 1781 ::::::::::::::::[[[[[[:::((((]]]]]]::::::::::::)))):::