Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
TVCV |
PKB-number: | PKB25 |
Definition: | tRNA-like structure 3'end pseudoknot of turnip vein-clearing virus |
Organism: | turnip vein-clearing virus |
Abbreviation: | TVCV |
RNA type: | Viral tRNA-like |
Keywords: | tobamovirus; RNA 3'end |
EMBL number: | U03387 |
Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
Supported by: | Sequence comparison |
References: |
[1] Lartey RT, Voss TC, Melcher U. Gene 1995, 166:331-332.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324. |
Stem sizes: Loop sizes: |
3 4 2 0 2 |
Position Paired: | 6290-6292; 6299-6301 6295-6298; 6304-6307 |
Bracket view of structure: |
6280 6290 6300 6310 # 56789|123456789|123456789|123456789|1 $ 6275 GAGGUUCGAAUCCUCCCUAACCCCGGGUAGGGGCCCA=6311 % 6275 :::::::::::::::(((::[[[[)))::]]]]::::