 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
PEMV |  |
|||
| PKB-number: | PKB45 |
| Definition: | ORF2/ORF3 (putative RNA-dependent RNA polymerase) ribosomal frameshift site of pea enation mosaic virus |
| Organism: | pea enation mosaic virus |
| Abbreviation: | PEMV |
| RNA type: | Viral Frameshift |
| Keywords: | enamovirus; ribosomal frameshifting; RNA polymerase |
| EMBL number: | L04573 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Demler SA; de Zoeten GA. J.Gen.Virol.1991, 72:1819-1834.
[2] ten Dam EB. (1995). Ph.D.Thesis, Leiden University. |
| Stem sizes: Loop sizes: |
6 4 2 0 6 |
| Position Paired: | 2042-2047; 2054-2059 2050-2053; 2066-2069 |
| Bracket view of structure: |
2030 2040 2050 2060
# 9|123456789|123456789|123456789|123456789
$ 2029 GGGAAACGGAUUAUUCCGGUCGACUCCGGAGAAACAAAGUC=2069
% 2029 :::::::::::::((((((::[[[[))))))::::::]]]]