 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Tt-LSU_P3/P7 |  |
|||
| PKB-number: | PKB77 |
| Definition: | The P3/P7 pseudoknot of the Tetrahymena ribozyme |
| Organism: | Tetrahymena thermophila |
| Abbreviation: | Tt-LSU_P3/P7 |
| RNA type: | Ribozymes |
| Keywords: | self-splicing; long distance interaction; Ciliophora |
| EMBL number: | V01416 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Crystal structure; Mutagenesis; Sequence comparison; Structure probing |
| References: |
[1] Cech T.R. (1990). Annu. Rev. Biochem. 59:543-568.
[2] Michel F. & Westhof E. (1990). J. Mol. Biol. 216:585-610. [3] Golden B.L., Gooding A.R., Podell E.R. & Cech T.R. (1998). Science 282:259-264. |
| Comment: |
The Tetrahymena ribozyme is the representative structure of group I introns
(for review see [1]).
The conserved structure of the introns, deduced from comparative analysis
[2], is mainly in agreement with the crystal structure [3].
The numbering is according to the EMBL database entry (V01416): the 5'-end position 147 of the stem P3 corresponds to the position 96 in the full-length intron. Non-Watson-Crick contacts, identified in the crystal structure [3], are: U152 * U324 (U101 * U273 in full-length intron numbering, stem P3); A155 * A321 (A104 * A270, stem P3); G330 * A350 (G279 * A299, stem P8); A320 * A357 (A269 * A306, stem P7). |
| Stem sizes: Loop sizes: |
7 6 158 2 28 |
| Position Paired: | 147-151; 325-329 153-154; 322-323 331-337; 343-349 313-313; 363-363 315-319; 358-362 |
| Bracket view of structure: |
150
# 6789|123456 (154)
$ 146 AGACCGUCAAA=156
% 146 :(((((:((::
320 330 340 350 360
#(154)123456789|123456789|123456789|123456789|123456789|1234
$ 311 CACAGACUAAAUGUCGGUCGGGGAAGAUGUAUUCUUCUCAUAAGAUAUAGUCGG=364
% 311 ::[:[[[[[::)):))))):(((((((:::::)))))))::::::::]]]]]]: