Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Tt-LSU_P3/P7

PKB-number: PKB77
Definition: The P3/P7 pseudoknot of the Tetrahymena ribozyme
Organism: Tetrahymena thermophila
Abbreviation: Tt-LSU_P3/P7
RNA type: Ribozymes
Keywords: self-splicing; long distance interaction; Ciliophora
EMBL number: V01416
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Crystal structure; Mutagenesis; Sequence comparison; Structure probing
References: [1] Cech T.R. (1990). Annu. Rev. Biochem. 59:543-568.
[2] Michel F. & Westhof E. (1990). J. Mol. Biol. 216:585-610.
[3] Golden B.L., Gooding A.R., Podell E.R. & Cech T.R. (1998). Science 282:259-264.
Comment: The Tetrahymena ribozyme is the representative structure of group I introns (for review see [1]). The conserved structure of the introns, deduced from comparative analysis [2], is mainly in agreement with the crystal structure [3].
The numbering is according to the EMBL database entry (V01416): the 5'-end position 147 of the stem P3 corresponds to the position 96 in the full-length intron.
Non-Watson-Crick contacts, identified in the crystal structure [3], are:
U152 * U324 (U101 * U273 in full-length intron numbering, stem P3);
A155 * A321 (A104 * A270, stem P3);
G330 * A350 (G279 * A299, stem P8);
A320 * A357 (A269 * A306, stem P7).
Stem sizes:
Loop sizes:
7 6
158 2 28
Position Paired:
147-151; 325-329
153-154; 322-323
331-337; 343-349
313-313; 363-363
315-319; 358-362
Bracket view of structure:
               150
      #      6789|123456 (154)
      $  146 AGACCGUCAAA=156
      %  146 :(((((:((::
                   320       330       340       350      360
      #(154)123456789|123456789|123456789|123456789|123456789|1234
      $ 311 CACAGACUAAAUGUCGGUCGGGGAAGAUGUAUUCUUCUCAUAAGAUAUAGUCGG=364
      % 311 ::[:[[[[[::)):))))):(((((((:::::)))))))::::::::]]]]]]:

Home
Visits
Visiters
© Eke van Batenburg