Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
STMV_UPD2-PK2 |
PKB-number: | PKB101 |
Definition: | Pseudoknot PK2 of the upstream pseudoknot domain (UPD2) of the 3'-UTR of satellite tobacco mosaic virus |
Organism: | satellite tobacco mosaic virus |
Abbreviation: | STMV_UPD2-PK2 |
RNA type: | Viral 3 UTR |
Keywords: | tobamovirus; satellite virus; translational regulation |
EMBL number: | M25782 |
Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
Supported by: | Sequence comparison |
References: |
[1] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
[2] Gultyaev A.P. et al. (1994). J. Gen. Virol. 75:2851-2856. [3] Felden B. et al. (1994). Nucleic Acids Res. 22:2882-2886. |
Comment: | The relatively long 3'-UTR of STMV RNA is predicted to have two upstream pseudoknot domains (UPD). The UPD1 is located just upstream of the 3'-terminal tRNA-like structure, similar to structures in helper viruses [1-3], the UPD2 is in the 5'-proximal part of the 3'-UTR [2]. |
Stem sizes: Loop sizes: |
4 6 1 0 3 |
Position Paired: | 682-685; 693-696 687-692; 700-705 |
Bracket view of structure: |
690 700 # 123456789|123456789|123456 $ 681 CGCUCCUCGCUUGAGCUUGAGGCGGC=706 % 681 :((((:[[[[[[)))):::]]]]]]: