 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BSBV1_UPD-PKb |  |
|||
| PKB-number: | PKB116 |
| Definition: | Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet soil-borne virus RNA 1 |
| Organism: | beet soil-borne virus |
| Abbreviation: | BSBV1_UPD-PKb |
| RNA type: | Viral 3 UTR |
| Keywords: | furovirus; pomovirus |
| EMBL number: | Z97873 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036. |
| Stem sizes: Loop sizes: |
4 6 4 0 6 |
| Position Paired: | 5659-5662; 5673-5676 5667-5671; 5685-5689 5672-5672; 5683-5683 |
| Bracket view of structure: |
5660 5670 5680 5690
# 89|123456789|123456789|123456789|
$ 5658 CAGUGUUUUGAAGUCCACUUAAAUAGAACUUCU=5690
% 5658 :((((::::[[[[[[))))::::::]:]]]]]: