 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
PSLVbeta_UPD-PK1 |  |
|||
| PKB-number: | PKB165 |
| Definition: | Pseudoknot PK1 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA beta |
| Organism: | poa semilatent virus |
| Abbreviation: | PSLVbeta_UPD-PK1 |
| RNA type: | Viral 3 UTR |
| Keywords: | hordeivirus |
| EMBL number: | M81486 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Solovyev A.G. et al. (1996). Virology 219:9-18. |
| Stem sizes: Loop sizes: |
3 5 1 0 4 |
| Position Paired: | 3359-3361; 3368-3370 3363-3367; 3375-3379 |
| Bracket view of structure: |
3360 3370 3380
# 89|123456789|123456789|
$ 3358 AUUGCCACUGUGGAAAUCAGUGA=3380
% 3358 :(((:[[[[[)))::::]]]]]: