Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
drz_Tatr_1

PKB-number: PKB342
Definition: HDV-like ribozyme
Organism: Trichoderma atroviride
Abbreviation: drz_Tatr_1
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: BK006897
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Webb CH, Riccitelli NJ, Ruminski DJ & Luptak A (2009). Science 326:953.
Stem sizes:
Loop sizes:
7 7 3 2
9 0 1 4 0
Position Paired:
1 -7 ; 37-43
17-23; 82-88
24-26; 34-36
28-29; 44-45
49-58; 68-77
Bracket view of structure:
            10        20        30        40        50        60        70        80
#   123456789|123456789|123456789|123456789|123456789|123456789|123456789|123456789|12345678
$ 1 GGACAACGAAAUCGGCCUCUGCAACCUCCACGUGGUGUUGUCUGGGAACCUGAUCAAAACUACCGAGUUUGAUCAGGCCAAUGCAGAG=88
% 1 (((((((:::::::::[[[[[[[(((:[[::::))))))))))]]:::((((((((((:::::::::))))))))))::::]]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00342.HTML