Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
KUNV |
PKB-number: | PKB346 |
Definition: | NS1' ribosomal frameshift site of West Nile virus |
Organism: | West Nile virus, Kunijn subtype |
Abbreviation: | KUNV |
RNA type: | Viral Frameshift |
Keywords: | Flaviviridae; ribosomal frameshifting |
EMBL number: | AY274504 |
Submitted by: | A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl) |
Supported by: | Mutagenesis,Sequence comparison |
References: |
[1] Firth AE & Atkins JF (2009). Virol. J. 6:14.
[2] Melian EB et al. (2010). J. Virol. 84:1641-1647. |
Comment: | |
Stem sizes: Loop sizes: |
11 7 6 3 17 |
Position Paired: | 3558-3568; 3585-3595 |
Bracket view of structure: |
3550 3560 3570 3580 3590 3600 # 6789|123456789|123456789|123456789|123456789|123456789| $ 3546 UCCUUUUCAGCUGGGCCUUCUGGUCGUGUUCUUGGCCACCCAGGAGGUCCUUCGC=3600 % 3546 ::::::::::::(((((((((((::::::[[[[[[[:::))))))))))):((:: 3610 3620 # 123456789|123456789| $ 3601 AAGAGGUGGACAGCCAAGAU=3620 % 3601 ::))::::::::]]]]]]]: