Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
CVV3 |
PKB-number: | PKB389 |
Definition: | tRNA-like structure pseudoknot of RNA3 |
Organism: | Citrus variegation virus |
Abbreviation: | CVV3 |
RNA type: | Viral tRNA-like |
Keywords: | Bromoviridae; Ilarvirus |
EMBL number: | NC_009536 |
Submitted by: | A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl) |
Supported by: | Sequence comparison |
References: |
[1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83. |
Stem sizes: Loop sizes: |
16 4 6 0 66 |
Position Paired: | 2183-2192; 2226-2235 |
Bracket view of structure: |
2190 2200 2210 2220 2230 2240 2250 # 123456789|123456789|123456789|123456789|123456789|123456789|123456789| $ 2181 AAGUCUAUAUGCCCACCUUUGCUACUCCGGGUGGAUGUUCUAAGUGUAUAUAGAUGCCUAUAUUUGAAAU=2250 % 2181 ::((((((((((((((((::::::[[[[)))))):::::::::::))))))))))::(((((((:::::: 2260 2270 2280 2290 2300 # 123456789|123456789|123456789|123456789|123456789|123456789 $ 2251 AAUAUAGAUGCCCAAACUCUCUCUCAUGGAGAGAGAAUGGAUGCCUCCGAAGGAGAUGC=2309 % 2251 )))))))::::(((::(((((((:::::)))))))::))):::::::::::]]]]::::