Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
ApMV3 |
PKB-number: | PKB397 |
Definition: | tRNA-like structure pseudoknot of RNA3 |
Organism: | Apple mosaic virus |
Abbreviation: | ApMV3 |
RNA type: | Viral tRNA-like |
Keywords: | Bromoviridae; Ilarvirus |
EMBL number: | NC_003480 |
Submitted by: | A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl) |
Supported by: | Sequence comparison |
References: |
[1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83. |
Stem sizes: Loop sizes: |
13 6 1 2 56 |
Position Paired: | 1953-1959; 1987-1993 |
Bracket view of structure: |
1960 1970 1980 1990 2000 2010 # 123456789|123456789|123456789|123456789|123456789|123456789|12345 $ 1951 CAGUUUUCCGAGCGUCGCCUCCUUAGGCGUGUCCUAGGAAAACAACAACUCGAUGUAGAGUUGAU=2015 % 1951 ::(((((((:((((((:[[[[[[::))))::::)):)))))))::((((((::::::)))))):: 2020 2030 2040 2050 # 6789|123456789|123456789|123456789|123456 $ 2016 UCCAAUUUCUGUGAAAGAAAUUGAUGCCCCGAUUAGGAGGC=2056 % 2016 ::((((((((:::::)))))))):::::::::::]]]]]]: