 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BQCV_IRES-PKII |  |
|||
| PKB-number: | PKB228 |
| Definition: | Pseudoknot PKII of the internal ribosomal entry site (IRES) region |
| Organism: | Black queen cell virus |
| Abbreviation: | BQCV_IRES-PKII |
| RNA type: | Viral others |
| Keywords: | Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus |
| EMBL number: | AF183905 |
| Submitted by: | A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274. |
| Stem sizes: Loop sizes: |
19 7 10 6 68 |
| Position Paired: | 5647-5655; 5709-5717 5662-5671; 5695-5704 5682-5688; 5786-5792 |
| Bracket view of structure: |
5650 5660 5670 5680 5690 5700 5710
# 6789|123456789|123456789|123456789|123456789|123456789|123456789|12345678 (66)
$ 5646 ACCAACAAUGUGAUCUUGCUUGCGGAGGCAAAAUUUGCACAGUAUAAAAUCUGCAAGUAGUGCUAUUGUUGGA=5718
% 5646 :(((((((((::::::((((((((((::::::::::[[[[[[[::::::))))))))))::::))))))))):
5790
# (66) 56789|123
$ 5785 AACUGUGCU=5793
% 5785 :]]]]]]]: