 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
WNV_PK3 |  |
|||
| PKB-number: | PKB237 |
| Definition: | A 3'-terminal pseudoknot |
| Organism: | West Nile virus |
| Abbreviation: | WNV_PK3end |
| RNA type: | Viral 3 UTR |
| Keywords: | Flaviviridae; Japanese encephalitis virus group |
| EMBL number: | M12294 |
| Submitted by: | A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison; Structure probing; thermal melting |
| References: |
[1]Shi P.Y., Brinton M.A., Veal J.M., Zhong Y.Y. & Wilson W.D. (1996). Biochemistry 35:4222-4230.
[2] Proutski V., Gould E.A. & Holmes E.C. (1997). Nucleic Acids Res. 25:1194-1202. |
| Comment: | Similar pseudoknots can be folded in other flaviviruses. |
| Stem sizes: Loop sizes: |
5 4 2 0 6 |
| Position Paired: | 10868-10872; 10879-10883 10875-10878; 10890-10893 10895-10897; 10949-10951 10898-10901; 10944-10947 10903-10911; 10934-10942 10913-10916; 10924-10927 |
| Bracket view of structure: |
10870 10880 10890 10900 10910 10920
# 789|123456789|123456789|123456789|123456789|123456789|
$ 10867 ACCUGGGAUAGACUAGGGGAUCUUCUGCUCUGCACAACCAGCCACACGGCACAG=10920
% 10867 :(((((::[[[[)))))::::::]]]]:(((((((:(((((((((:((((::::
10930 10940 10950 10960
# 123456789|123456789|123456789|123456789|12
$ 10921 UGCGCCGACAUAGGUGGCUGGUGGUGCUAGAACACAGGAUCU=10962
% 10921 :::))))::::::))))))))):)))):))):::::::::::